Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST318786
Clone ID OST318786
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST318786
Sequence
GAACTGAGTACAGCGATATTTCAAGAGAAGCCCGAGGTCCCTTTGAGAATGGAGTGATATTTCAAAAATGCTCACTGGTG
TCTGGGCAGAGCAGAATCGCAGACCATGCACGTGCAGCATGTCCGTGAACAACACCAGGACGCCCACATCAGTCAACCTT
TCGAACCTGCTCGTGCTAGATGAGATCACTGGCCTTGCTGTGAAGGAGTCGCCTGGAAATAATACTCAGGATGGAATCCA
GACTTTCAGAAAGAGCTTTCTGCAAGTGGGAGAATGCTACTCTGTCAGCTACACAGCCTCGCTGGACCCCACAGCCCTTG
GGACTGGGGAGAGCCTGGATCTTCCTGCCCGGCTCATCTTTCAGAGCCCCTCACAGAACAGAACTCAGCTAAAAGCCCCC
TTTACCATCACAGTGGAAGAAAAGATAATGGTTCTTCCTANCCATGGTCTNNACNCAGCAGGNTNCATCNTAGNCTTNCT
CATNTCCCTNCTCCTGACCGTGGCNGCCCTGTTCTTCTTGGNNAGGGGTCGATGTCTGA
Sequence Type mRNA
Unitrap ID UNI21757

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 37738677..37748746 182
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000050248 (Evc2) NM_145920 Ellis van Creveld syndrome 2 homolog (human) Gene [Source:MGI Symbol;Acc:MGI:1915775]

 
Come back to gene ENSMUSG00000050248


For any suggestions or comments, please send an email to unitrap@crg.es