Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST318639
Clone ID OST318639
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST318639
Sequence
TAAACATTGGAAATAATACANGTCACGCGTTCATGTGATGATCACAGNCCTTCCTCTGGATTCACCCTCAGTGACAGGAT
GTGAGAAAAGAGTTACATGCGAATATGAGTCAG
Sequence Type mRNA
Unitrap ID UNI21668

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 51209453..51211277 78
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037152 (Ndufc1) NM_025523 NADH dehydrogenase (ubiquinone) 1, subcomplex unknown, 1 Gene [Source:MGI (curated);Acc:Ndufc1-001]

 
Come back to gene ENSMUSG00000037152


For any suggestions or comments, please send an email to unitrap@crg.es