Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST318591
Clone ID OST318591
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST318591
Sequence
CGTTCTATGACCCGTNCCTACTACAGGGGAGCAGCATGGAGCCCTGCTGGTGNATGACATCACTGAGACGCGANACCTTC
AACCACCTGACCTCATGGTTAGAGGACGCCCGCCAGCACTCCAGCTCCAACATGGNTATAATGCTGATCGGGAATAAGAG
TGATCTAGAATCTCGAAGGGATGTGAAGAGAGAGGAAGGAGAGGCCTTTGCTCGTGAGCACGGCCTTATATTCATGGAAA
CATCGGCCAAGACAGCCTGCAATGTTGAAGAGGCCTACATTAATACAGCCAAAGAAATATATAGGAAGATCCAGCAAGGT
TTATTTGATGTCCACAATGAGGCAAATGGCATCNAGATTGGGCCCCAGCANTCAATTACCTGCTCAGTAGGACCGTGCTC
CCCTCANCAGAACGTTTCTGATATAGGGCCTGACTNTGGNTGCTGCTGAACACCGGGCCTGANTGAGCGCTTTCTCTTTC
CTCTCCGGGAGCA
Sequence Type mRNA
Unitrap ID UNI21763

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 52883341..52888657 136
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022159 (Rab2b) NM_172601 RAB2B, member RAS oncogene family Gene [Source:MGI Symbol;Acc:MGI:1923588]

 
Come back to gene ENSMUSG00000022159


For any suggestions or comments, please send an email to unitrap@crg.es