Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AW0826
Clone ID AW0826
Vector pGT0lxr
Project sanger

Sequence tag AW0826
Sequence
TTGTGAGCTCTTTTTGGGTGGTTTTTTTTACGGATAATTTTTTTTTTTTTAGGGACTGGGAAGGTGGCGGCGGCGAAGGC
GCTGGCGGTTGAGGTTGCTCCGAGCCAGGTAACTATGAAAGGCTTGTATTTTCAACAGAATTCTACAAATGAAGAAGTAA
CATTTGTATTTCAAGAAAAG
Sequence Type mRNA
Unitrap ID UNI4610

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 91717649..91728858 72
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000058240 (Cryzl1) NM_133679 crystallin, zeta (quinone reductase)-like 1 Gene [Source:MGI (curated);Acc:Cryzl1-003]

 
Come back to gene ENSMUSG00000058240


For any suggestions or comments, please send an email to unitrap@crg.es