Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST318540
Clone ID OST318540
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST318540
Sequence
AAGGCCTTAAGATGGGANATTGCAANGTTACATCCGNACTTNATTCTGGCAGNGAGTTCAANGCTCCNNCNTTCNNTATA
GCCNNNNGATNGGCATNTGNNGACNNGNACCTTNGTNGCCGAAAAGCCTATGAAGACTGGCAAACCCCTCCAACCAAAAC
AGCCGACCTTGACTGGGAAAAAGATCACCGAGAAGTCTACTAAGACACAAAGTTCTGTTCCTGCTCCTGATGATGCCTAC
CCAGAAATAGAAAAGTTCTTCCCTTTCAATCCTCTAGACTTTGAGAGTTTTGACCTGCCTGAGGAGCACCAGATCTCACT
TCTCCCCTTGAATGGCGTGCCTCTCATGACCCTGAATGAAGAGAGAGGGCTGGAGAAGCTGCTGCC
Sequence Type mRNA
Unitrap ID UNI21768

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 43234660..43238397 110
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020415 (Pttg1) NM_013917 pituitary tumor-transforming 1 Gene [Source:MGI (curated);Acc:Pttg1-001]

 
Come back to gene ENSMUSG00000020415


For any suggestions or comments, please send an email to unitrap@crg.es