Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST318519
Clone ID OST318519
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST318519
Sequence
TCCTTCAGCAATATAACCACTATANATCCAATATGGAGATTTTCAAGTTACAACCAANTAAGCCCAGCAAAGAGCTGGCA
GAGCTGGTGATGTTCATGGCACAGATTGGCCAGTGCTACCCGGAGCATCTCAGTAACTTCCCGCAGGAGCTGAAGGACCT
GCTCTCCTACAACCACACTGTCTTAGACCCAGATCTCCGCATGACGTTTTGCAAAGCCTTGATCTTACTGAGAAACAAGA
ATCTCATCAATCCATCAAGTTTGCTAGAGCTCTTCTTTGAGCTGCTGCGCTGCCACGACAAGCTCCTGCGGAAGACTCTG
TACACACACATTGTGACTGATATCAAGAACATCAACGCCAAACACAAGAACAACAAAGTGAACGTGGTGCTGCAGAACTT
CATGTACACCATGTTGAGAGACAGCAATGCAACCGCAGCCAAGATGTCCTTGGATGTGATGATCGAACTCTACAGAAGGA
Sequence Type mRNA
Unitrap ID UNI21770

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 92732699..92734862 113
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029415 (Sdad1) NM_172713 SDA1 domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:2140779]

 
Come back to gene ENSMUSG00000029415


For any suggestions or comments, please send an email to unitrap@crg.es