Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST318205
Clone ID OST318205
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST318205
Sequence
GACTGAGAAGCTGCTTTGCAGACAATAGGAGAGGACCAAGGTCAGAACCCCTATACTGAACTGCTGGTACTGGAGGCTCA
TCGCGACATTGTCCGCTTCCTGGTGAGGCTCGATGACTTCAGGTTTGCATCTGCTGGCGATGATGGAATTATAGTTGTGT
GGAATGCCCAGACAGGAGAAAAACTTCTGGAACTCAGAGGACACACTCAGAAGATAACGGCTGTCATTGCGTTTCCTCCC
CTAGACTCGTGTGAGGCCAGCAGTCAGCTTCTCTTGACAGCCTCGGCTGACCGGACTGTCGGTGTTTGGGATTGCGACAC
CGGCCGGCAAATCCAGAGAGTCACGTGCTTCCAGTCTACGGTAAAGGNAAAATCTNCANCAATATTGGGTTCCTTTGGGA
ATATTT
Sequence Type mRNA
Unitrap ID UNI21777

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 95748426..95769922 135
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042015 (Wdr41) NP_766178 WD repeat domain 41 Gene [Source:MGI Symbol;Acc:MGI:2445123]

 
Come back to gene ENSMUSG00000042015


For any suggestions or comments, please send an email to unitrap@crg.es