Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AT0947
Clone ID AT0947
Vector pGT0lxr
Project sanger

Sequence tag AT0947
Sequence
TTTTTTAAAAGGGTTTTTTTTTGTTTTTTGCTGGCGGAGACAGCATGGCGGCGGGGGCGGCCGAGGCAGGCGAGGCAGCC
GTGGCAGTGGTGGAAGTCGGCTCTGCCCAGCAGTTTGAAGAGCTACTGCGCCTCAAAACCAAGTCACTCCTTGTGGTTCA
TTTCTGGGCACCATGGGCTCCACAGTGTGTACAGATGAACGATGTCATGGCAGAGTTAGCTAAAGAACACCCTCATGTTT
CATTTGTGAAG
Sequence Type mRNA
Unitrap ID UNI4616

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 144629343..144636770 114
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031068 (Glrx3) NM_023140 glutaredoxin 3 Gene [Source:MGI Symbol;Acc:MGI:1353653]

 
Come back to gene ENSMUSG00000031068


For any suggestions or comments, please send an email to unitrap@crg.es