Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST317557
Clone ID OST317557
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST317557
Sequence
GACTGAGATGTCCAAGATCCTGATAGTTTTCATGAAGAAACTGTGGAACCAAAACCAGAACTGAAGGAACCGGAACCAAA
GGAACCAGAACCGAAGGAACCAGAAAGGAAGGAACCAGAAAGGAAGGAACCAGAAAGGAAGGAACCAGAAAGGAAGGAAC
CAGAAAGGAAGGTACCAGGAAGAAGGGAAACACAAACGAAGGAAACACAAACAACCGAAATAGAAAGGAAGGAAACAAAA
AAGAA
Sequence Type mRNA
Unitrap ID UNI21798

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 135020419..135020659 237
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000050150 (Nhedc1) NM_028946 Na+/H+ exchanger domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:1921696]

 
Come back to gene ENSMUSG00000050150


For any suggestions or comments, please send an email to unitrap@crg.es