Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST317494
Clone ID OST317494
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST317494
Sequence
ACTGAGTTTACAAGATTCCTTTGCAGCTCCCATTGGAGGCAGAGCACCCTGCTGATGGACCAGAATGTGGTTNTGGCTCC
TTTCACCAGCAGTACTGGCTCGATGGGAAGATCATTGCTGCGGGGGTGNTAGACATTCTCCCGTACTGNGNGTCTTCTGT
GTATCTCTACTACGATCCTGATTATNCATTTCTGTCTTTGGGNGTCTATTCNTCATTANNAGAANTNGCTTTNNCTANAC
AACTGCNTGACAAAACNTCNCAACTNAGNTNTNATTATATGGNTTTCTACATTCATTCCTGTCCCAAGANGAGATACAAG
GNNNNANATAGACCNTNNGATTTGCCTGTGACCNCGANACGTATGTNGTGGGGGCCCATTGANCAATGCCTGCCTTCTCT
GNACAACGTGCAAGTACTGCCGTGCTCAACCAGGACNCACGAAGCNGACGATGACTGACGCCAGTAGGGAACCTTGACCG
ACTAAGGG
Sequence Type mRNA
Unitrap ID UNI21799

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 137538212..137625231 164
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000030850 (Ate1) NM_001029895 arginyltransferase 1 Gene [Source:MGI Symbol;Acc:MGI:1333870]

 
Come back to gene ENSMUSG00000030850


For any suggestions or comments, please send an email to unitrap@crg.es