Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST317483
Clone ID OST317483
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST317483
Sequence
CATGCTCTCTGGAAGGGAAAAGAANANGACTTGGCTGNTTAAGACACACATGAACCTTGGATAAGTGTGGNATCCANGCA
GANGCCAAGCTCCAGNTCACCCCGCAGCACAAACTGCTCCGCCTGCAGCTTCCCAACATGAAGTATGTGAAGGTGAAAGT
GAACTTCTCTGACCGAGTCTTCAAGGCTGTGTCTGACATCTGCAAGACTTTCAATATAAGACACCCTGAAGAACTTTCTC
TCTTAAAAAAACCCAGAGATCCCACAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI15899

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 46102180..46124382 188
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037712 (Plekhc1) NM_146054 fermitin family homolog 2 (Drosophila) Gene [Source:MGI (curated);Acc:Plekhc1-001]

 
Come back to gene ENSMUSG00000037712


For any suggestions or comments, please send an email to unitrap@crg.es