Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AS0681
Clone ID AS0681
Vector pGT0lxr
Project sanger

Sequence tag AS0681
Sequence
TGGCTTTAAATGCAAAGGTGGTTGGAGGTCCTCATGGAGACAAGGACAAAATGGTGGCTGTCGCCTCAGAGAGCAGCATC
ATCTTGTGGAGTGTTCAGGATGGAGGAAGTGGAAGTGAAATTGGTGTGTTCAGCCTCGGCGTTCCAGTAGTTTTTTTTTT
GTTTTTTTGAAACGGGTTTTTTTTTTTTGAGTCACACGGGGAAGGTGGGCGTGTGGAACGCTGTCACGCAGCACTGGCAG
GTCCCA
Sequence Type mRNA
Unitrap ID UNI4622

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 190811393..190816564 125
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026608 (Kctd3) NM_172650 potassium channel tetramerisation domain containing 3 Gene [Source:MGI Symbol;Acc:MGI:2444629]

 
Come back to gene ENSMUSG00000026608


For any suggestions or comments, please send an email to unitrap@crg.es