Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST317055
Clone ID OST317055
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST317055
Sequence
GACTGAGTCCTGGTACCTGGGGTAGCCGAGGTTGCCTTCCCATCCCTCCTTCATCACCGGTGGAGTCCCAGGGTGACAGT
CCCAGCCTGCATTTTTGGTGGAAAATTAGATGGAGTGAGAAGCCCCCTGCGGACTCCCAGCTGGATGGAAAAGACAGGAG
GAGAAAAGGACAAAGACAAACAGGAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI16523

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 80863630..80863818 189
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000055053 (Nfic) NM_008688 nuclear factor I/C Gene [Source:MGI (curated);Acc:Nfic-004]

 
Come back to gene ENSMUSG00000055053


For any suggestions or comments, please send an email to unitrap@crg.es