Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST316933
Clone ID OST316933
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST316933
Sequence
GTTTTGAGGGACACGGGTCTGGCTTGANAAAATGGCCAGCATTTTCCGAGTACTGTAAATTCCTGTGCAGAAGGCGTCGT
GGTCTTCCAGACAGACTATGGGCAGAAATTCTGTACCTCACGTGGCCATCGGGATCAGACTCGTTGAGTAAACAGTAGAA
ATGTCAGCCCCTTCAGTTACTCTGGGGAAAGGGAATCGAAGCCATCTGGCCTGTGTGCGCCTTTAGTAGGCTGGCTCTGA
AGACAGCAAACGAGCCTTTGTTTTTTGGGTCAAAGCAGATGTGCTTAGCCTGCCATCTTAATTTCTTTTGTATGGTTTGG
CATATATTTCAGCTGCTTTGAAATGTTGAAAAGCTTTCAAACCAAATTGGGGAAGAACAAAATAAATTGATTTTTTTTTT
CCNTAACTGAGTTTTCCAGTTCANATACTTCGNGAACAAGTATCTTCAGAAATGAATACATTTATTTAACACCAAAAAAA
AAA
Sequence Type mRNA
Unitrap ID UNI20524

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 25596179..25613351 366
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022272 (Myo10) NM_019472 myosin X Gene [Source:MGI (curated);Acc:Myo10-001]

 
Come back to gene ENSMUSG00000022272


For any suggestions or comments, please send an email to unitrap@crg.es