Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST316867
Clone ID OST316867
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST316867
Sequence
GACTGAGGTTTTGCTGTCTCTAAGCCTTCCTGGTGACATTTCTGGAGCAAAGACAAGGGCCTTGGGATATGAAGAGACAA
GGAACGGCCACTGTGTACCCAGGAATAATACCCAATGATCCTAAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI21818

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 67468277..67473210 92
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000078995 (Zfp456) NM_001001186 zinc finger protein 456 Gene [Source:MGI Symbol;Acc:MGI:3040694]

 
Come back to gene ENSMUSG00000078995


For any suggestions or comments, please send an email to unitrap@crg.es