Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AR0051
Clone ID AR0051
Vector pGT0lxr
Project sanger

Sequence tag AR0051
Sequence
TTTTTTTTTGGTTGTGAGCTCTTCTAGATGGTTTTTACATTTTCTCCCTAGGGCTTTGTAAAGGATGTCCATGAAGACTC
TGTCACTATCTTCTTTGAGAACAACTGGCAGAGTGAGAGACAGATTCCCTTTGGGGATGTCCGACTACCGCCTCCAGCTG
ACTACAATAAGGAAATCACAGAAGGAGATGAAGTAGAGGTCCNCA
Sequence Type mRNA
Unitrap ID UNI4636

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 69452868..69453831 96
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018765 (Fxr2) NM_011814 fragile X mental retardation, autosomal homolog 2 Gene [Source:MGI (curated);Acc:Fxr2-006]

 
Come back to gene ENSMUSG00000018765


For any suggestions or comments, please send an email to unitrap@crg.es