Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST316221
Clone ID OST316221
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST316221
Sequence
ACTGAGAGACGATCTGACGAGCTACTCTCAGGCAGTGTTCTCAGCAGCCCCAACTCTAATATGAGTGGCATGGTAGTTAC
AGGTCATAAAAGGATGGAACACACTTCTTTCAGTTAACTAAAAACGGGAAAGTATATGCTAATTGCAGCATGATGGCGTG
GAAAGCCTGAATTTTTAGTACATATTATTTATTTTTCTGTACAATATAAAACGGTATCACAAGACCATGATTCTGACAAT
AAACCAATTAAATGTCTGCAAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI2934

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 119463472..119464698 178
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028134 (Ptbp2) NM_019550 polypyrimidine tract binding protein 2 Gene [Source:MGI Symbol;Acc:MGI:1860489]

 
Come back to gene ENSMUSG00000028134


For any suggestions or comments, please send an email to unitrap@crg.es