Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST316106
Clone ID OST316106
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST316106
Sequence
CTCTTATCCGAGAACTGTGCCACAGCTGTGCGGTGGTGTCCAGCTCTGGCCAGATGCTGGGTTCAGGCCTGGGTGCCCAG
ATCGATGGCGCAGAGTGCGTGCTACGCATGAACCAGGCACCCACCGTGGGCTTTGAGGAGGACGNGGGCCAGCGCANCAC
TCTGNGCCGTGATCTCTCACACAAGTGTGCCATTGCTTCTGCGCAACTACTCACACTATTTCCAGCATGCCCGAGACACG
CTCTACGTGGTGTGGGGCCAGGGCAGGCACATGGACAGGGTGCTGGGCGGCCGCACCTACCGAACGTTGCTGCAGCTCAC
CAGAATGTATCCAGGCCTGCAAGTGTACACCTTCACTGAACGCATGATGGCCTACTGTGACCAGATCTTCCAAGATGAGA
CAGGCAAGAACCGGAGACAATCAGGCTCCTTTCTCAGCACCGGTTGGTTCACCATGATTCTGGCCCTGGAGCTGTGCGAG
GAGATCGTGGTCTACGGGATGGTCAGCGATAGTTAC
Sequence Type mRNA
Unitrap ID UNI21833

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 32449511..32451316 405
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000079442 (St6galnac4) NP_035503 ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 4 Gene [Source:MGI (curated);Acc:St6galnac4-001]

 
Come back to gene ENSMUSG00000079442


For any suggestions or comments, please send an email to unitrap@crg.es