Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone GC1311
Clone ID GC1311
Cell line E14Tg2A.4
Vector pFLIP3
Project tigem
Note NULL

Sequence tag GC1311
Sequence
CGGGAGCATTTAGGGNATTTGAATCCGATGAGACCTTCTGCGAGATGGTGAAGTCCAATCGGCTCTGCGAACGGAAGCTC
TTCATCCAGTTTTGCTGCCGCACCTGCCTCCTGGCTGGGTAGGGGCACCAGCTGCCCGCAGAGGGCAGGGTCCTCCTGTC
TGCCCGTTTGCCCATCTACCTTCCTACAGATGGTCAGCCATAGCCTGTTCCTTGGGGTAGCCCTGCATCTGACAGCTGTA
TCTCCCCCAGAGCTGGGTTCTACTGCAGCATCTCTGAGCACCTGAACAGGTGGAGGTGGCCCTTAAGGATATGTGGCTAA
ATTGACAAAATTCCCCTTGAACTCTGCTTGCTGGCTGCAGTCTAAAGTTGGACTCAAAGCAGGAACAAAAAAAAAAAAAA
AAAAAATTGGGCCCCGGGTTTTAAGCCCCCGGGGACAAAAAAAAGAAAACCCCTGGTTGGGGGGGGCGGTATACCCCAAA
AANNTNNNNTNACATTAATTCTTTTTCTAGATATTAGTATAGACCTAATAATCATAACAAGGTTTGTTGGAAAGAACATT
TATGCGCTTTCCTATGATAAGGACCGCACTTCCATCT
Sequence Type mRNA
Unitrap ID UNI386

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 73193792..73438640 363
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000030513 (Pcsk6) proprotein convertase subtilisin/kexin type 6 Gene [Source:MGI Symbol;Acc:MGI:102897]

 
Come back to gene ENSMUSG00000030513


For any suggestions or comments, please send an email to unitrap@crg.es