Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AQ0010
Clone ID AQ0010
Vector pGT0lxr
Project sanger

Sequence tag AQ0010
Sequence
TTTTCAAAAGGTTTTTGTTGTGAGCTTTTTCAGAAGGTTTTTTTTTTATTGTTTTCATTTTAAGACTTACAGATTCAAAC
CTGAAGATCCCAGAGGAAAAGGCAGCAAAGGTTGCCACAAAAATTGAAAAAGAACTTTTCTCTTTTTTTCGGGACACGGA
TGCCAAGTATAAGAATAAATATAGAAGCTTGATGTTTAATCTAAAAGATCCTAAAAACAAT
Sequence Type mRNA
Unitrap ID UNI4645

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 30876926..30877099 174
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000048874 (Phf3) NM_001081080 PHD finger protein 3 Gene [Source:MGI Symbol;Acc:MGI:2446126]

 
Come back to gene ENSMUSG00000048874


For any suggestions or comments, please send an email to unitrap@crg.es