Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST315412
Clone ID OST315412
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST315412
Sequence
GACTGAGTATGACTTGTCGCCTCTACGTTCTCTCCTGATGGAAGAGTTTTCCAAGTTGAATATGCCATGAAGGCTGTGGA
AAACAGTAGTACAGCTATTGGGATCAGATGTAAAGATGGTGTTGTGTTTGGGGTAGAAAAACTAGTCCTTTCTAAACTTT
ATGAAGAAGGCCTCCAATAAACGTCTTTTTAATGTTGATCGACATGTTGGAATGGCAGTTGCAGGTTTGCTGGCAGATGC
TCGTTCATTAGCAGACATAGCGAGAGAAGAAGCATCCAACTTTAGGTCCAACTTCGGCTATAACATTCCTCTAAAACATC
TTGCAGACAGAGTGGCCATGTATGTACACGCCTATACACTCTACAGCGCTGTTAGACCTTTTGGCTGCAGTTTCATGTTG
GGGTCTTACAGTGCGAATGATGGTGCACAGCTCTATATGATCGACCCATCAGGTGTTTCATATGGTTACTGGGGCTGTGC
GATTGGCAAAGCCAGGCAGGCTG
Sequence Type mRNA
Unitrap ID UNI443

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 72079718..72089450 124
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000060073 (Psma3) NM_011184 proteasome (prosome, macropain) subunit, alpha type 3 Gene [Source:MGI Symbol;Acc:MGI:104883]

 
Come back to gene ENSMUSG00000060073


For any suggestions or comments, please send an email to unitrap@crg.es