Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST315386
Clone ID OST315386
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST315386
Sequence
GAACTGAGATGTCCTTTGGTCTTCTCCGAGTGTTCTCCATTGTGATCCCCTTTCTCTATGTCGGGACACTCATCAGCAAG
AACTTCGCTGCTCTGCTTGAGGAACATGACATTTTTGTCCCAGAGGATGACGACGACGACGATTAACAGGGCACAGGGAG
CACAGGAGAAAGCACTGATGATGTGGNGGCATGCTCAGCCTCCCTCCCGTCGGCAGAAGGGTCAAGGAAAGCCCTCAGCC
TCACCTCCTCATGGTTTGTGACAAGAGCCCAGAGTCCTGTGCTTTGGGAGGCTCCCTCACGGCTGTCCACAGAGTACTGG
AAATAACAAGCAAGCAAATTAGGAGTGTATAATAAATGAGTCATGTATGATGAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI13830

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 82178328..82179495 222
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022452 (1500032L24Rik) NM_026914 RIKEN cDNA 1500032L24 gene Gene [Source:MGI Symbol;Acc:MGI:1916279]

 
Come back to gene ENSMUSG00000022452


For any suggestions or comments, please send an email to unitrap@crg.es