Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST315324
Clone ID OST315324
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST315324
Sequence
GTACTGAGGGAAACAGATCTTGACAGTTGCTGTCATTGTACTTCGGTGCCAGGATGGAGGCCCCACTGGTGAGTCTGGAT
GAAGAGTTTGAAGATATCAGGCCCAGTTGCACTGAGGAGCCAGAGGAAAAGCCACAGTGTCTGTATGGCACATCTCCTCA
TCACCTGGAGGACCCTTCCCTNTCTGAGCTTGAGAATTTTTCTTCCGAAATAATCAGCTTCAAGTCCATGGAGGACCTCG
TGAATGAATTTGATGAGAAGCTCAATGTCTGCTTTCGGAACTACAACGCCAAGACGGAGAGCCTGGCTCCAGTGAAGATC
CAGCTGCAGATCCAGGAGGAGGAGGAGACTCTTCGGGATGAGGAGGTTTGGGATGCTCTGACAGACAATTACATCCCTTC
ACTCTCAGAAGACTGGAGGGACCCAAACATTGAAGCTCTGAATGGCAACAGCTCTGACATTGAGATTCATGAGAAGGAAG
AAGAAGAGTTCAATGAGAAGATCT
Sequence Type mRNA
Unitrap ID UNI17201

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 36651245..36668433 355
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032118 (Fez1) NM_183171 fasciculation and elongation protein zeta 1 (zygin I) Gene [Source:MGI Symbol;Acc:MGI:2670976]

 
Come back to gene ENSMUSG00000032118


For any suggestions or comments, please send an email to unitrap@crg.es