Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST315245
Clone ID OST315245
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST315245
Sequence
AGCCTCTGCTGGTTGTGCAGGAGGCCCTGAGGAAGTGCTTCCCTGTGGGGGAGGAACAGCAGAACCTGTGGCAGAGCACC
CTGCAGGACTGCTCGCCCCTCCTGTCCTCTNTCAGTAACCTGGCTGAGCAGCTGCAAGCCNGCACAGAGTCTGCGCTTTG
AGGATGTGCCAGCCCTGCGTCCNTTTCCAGACTTACAGGAGCGGTTGAGGCGCAAGCAGCTGGAGGCTGGTGACGTTGTT
CTGGACAAGCTAGCTGAGCGGCTGNAANAGGNTCTGNTGTCCCCNTTTGTTGATGGACAGATCTTAATGCCGNATGGCAT
CCCANCCTAAGNCAGGGGGTCCTACAGAAATCGACAAAAGCAAGTCAGGAGTAATCATGCTGGANCTAAGTTGAATGTCT
GNGAGTTCGAGGCCAGCCTGGACTACATTGTAAGACCATGCATGTCTTTAAAACAAAACAAA
Sequence Type mRNA
Unitrap ID UNI21862

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 124615700..124616160 430
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000044730 (9930104L06Rik) NP_808241 RIKEN cDNA 9930104L06 gene Gene [Source:MGI Symbol;Acc:MGI:3041172]

 
Come back to gene ENSMUSG00000044730


For any suggestions or comments, please send an email to unitrap@crg.es