Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AN1000
Clone ID AN1000
Vector pGT0lxr
Project sanger

Sequence tag AN1000
Sequence
TTTTTGGTTGTGAGCTCTTCTAGATGGTTTTTTGAGCGCCTCTACTGAGTGATGTGAGGGGATGTCCTAAGCTCAGAACT
CCAGACATGGATTTAGTCACCTATGATGACGTGCATGTCAACTTCACTCAGGAAGAATGGGCTTTGCTGGATCCTTCTCA
GAAGAGTCTCTACAAAG
Sequence Type mRNA
Unitrap ID UNI4654

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 174889408..174893263 89
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000078905 (OTTMUSG00000016546) NP_001079015 predicted gene, OTTMUSG00000016546 Gene [Source:MGI Symbol;Acc:MGI:3649576]

 
Come back to gene ENSMUSG00000078905


For any suggestions or comments, please send an email to unitrap@crg.es