Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST315063
Clone ID OST315063
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST315063
Sequence
AGAGATCCGGTCTGTTACCANAAATACGANTGAGCATGCTTATTCGGAAGCGTGCCATTCCANANATTGGNGAGGNAGAT
CGCCCAGGATTTNAAAACCGACTTGNGGTTTCAAAGNGCAGCCATCGGTGCCCTTCAGGAGGCTAGCGAAGCATACCTGG
NGGGGTTGTTTGAANATACCAATCTGNGNGCCATCCACNCCAAGAGAGTCACCATCATGCCCAAAGACATCCAGTTGGCT
CGCCGGATACGGGGGGAGAGAGCTTAAGTTGAAGCGGTTTTTATGGCATTTTGTAGTAAATTNTGTAAAATACTTTGGTT
Sequence Type mRNA
Unitrap ID UNI17899

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 115884668..115885071 173
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000016559 (H3f3b) NM_008211 H3 histone, family 3B Gene [Source:MGI (curated);Acc:H3f3b-001]

 
Come back to gene ENSMUSG00000016559


For any suggestions or comments, please send an email to unitrap@crg.es