Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AN0407
Clone ID AN0407
Vector pGT0lxr
Project sanger

Sequence tag AN0407
Sequence
GGTGGTTGTGTGCTGTTCTTGTTTGGTGGTTGTGAGCTTTTGTTGTTGGTGGTTGTGAGCTCTTCTAGATGGTGGTTGTG
AGCTCTTCTAGATGGTTTCTCTGCGGTGTGTCCTGAGTGCCTCTGCTGGGTGCTGTGAGGGAGCTCTGAAAAGCTTAAAA
TTTCCGGACATG
Sequence Type mRNA
Unitrap ID UNI4658

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 149403424..150007606 79
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000079009 (EG245174) predicted gene, EG245174 Gene [Source:MGI Symbol;Acc:MGI:3644476]

 
Come back to gene ENSMUSG00000079009


For any suggestions or comments, please send an email to unitrap@crg.es