Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AM0712
Clone ID AM0712
Vector pGT0lxr
Project sanger

Sequence tag AM0712
Sequence
ACATCAACCTGGATGTGAACAGGATCGTGGGGTCCCGTCACTTCTGCAACAAACTCTGGAATGCTACCAAGTTTGCCCTG
CGCGGCCTTGGGAAGGGCTTTGTGCCCTCAGCAACCTCCAAG
Sequence Type mRNA
Unitrap ID UNI4661

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 35151185..35151306 118
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000007029 (Vars) NM_011690 valyl-tRNA synthetase Gene [Source:MGI Symbol;Acc:MGI:90675]

 
Come back to gene ENSMUSG00000007029


For any suggestions or comments, please send an email to unitrap@crg.es