Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST314421
Clone ID OST314421
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST314421
Sequence
GACTGAGGTATCTGCTCAGTGAGTGGGCAGNCTGTTGTGGACCCCAAAGGCTACCTGACAGATCTAAATTCCATGATCCC
AACCCATGGCGGGGACATAAATGACATCAAGAAAGCACGACTACTTCTCAAATCTGTTCGAGAAACAAACCCTANNCTGC
CNCCTATNCTNNTNNAGGGTTANNNTGNCGGNAAGAAGTCACTGGAAAGTTACAAGTAGCTCGAANCCTTATTATGAAAG
GGACAGAGATGTGCCCCAAGAGNGAAGATGTCTGNCTAGAAGCAGCTAGGTTACAGCCTGGGGACACAGCCAAGGCTGTG
GTGGCACAAGCTGNCCGTCATCTCCCGCAGTCTGTTAGGATTTACATCAGAGCANCAGAGCTAGAAACAGACATTCGAGC
AAAGAAGCGTGTTCTTCGGAAAGCACTTGAGCATGTTCCAAACTCTGTTCGATTGTGGAAAGCAGCTGNTGAGCTTGAAG
AGCCTGAAGATGCT
Sequence Type mRNA
Unitrap ID UNI21902

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 181366138..181370808 160
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000002455 (Prpf6) NM_133701 PRP6 pre-mRNA splicing factor 6 homolog (yeast) Gene [Source:MGI Symbol;Acc:MGI:1922946]

 
Come back to gene ENSMUSG00000002455


For any suggestions or comments, please send an email to unitrap@crg.es