Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST314395
Clone ID OST314395
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST314395
Sequence
GACTGAGCCCCGTGCCGATCCCATTCCAATATGTAGCTTCTGTTTGGGGACTAAAGAGTCAAATCGTGAAAAGAAACCAG
AAGAACTCCTGTCTTGTGCAGATTGTGGCAGTAGTGCCCACCCNNCCTGCCTGACGNTTGNGTNCTGAGCTAACNAGCAA
ATGTNAAGGCNTTCCNGTGCNCATTACANGGAGTGCAAGACAGTGCAGCGCATGTCGAGTCCAGGGCAAAAATGCAGATA
ACATGCTTTTTTGTGATTCCTGTGATAGAGGATTCCATATGGAGTGCTGTGACCCACCACTTTCCAGAATGCCAAAAGGG
ATGTGGATTTGCCAAGTCTGCAGACCAAAGAAAAAGGGAAGAAAACTACTTCATGAGAAAGCTGCACAAATAAAACGGCG
ATATGCAAAACCCATTGGACGACCGAAAAATAAATTAAAGCAACGATTGTTGTNGGTTGAGATCTTATNAAAAGAAATCT
TTTATGT
Sequence Type mRNA
Unitrap ID UNI3389

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 22428974..22441345 167
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021767 (Myst4) MYST histone acetyltransferase monocytic leukemia 4 Gene [Source:MGI Symbol;Acc:MGI:1858746]

 
Come back to gene ENSMUSG00000021767


For any suggestions or comments, please send an email to unitrap@crg.es