Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST313748
Clone ID OST313748
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST313748
Sequence
TGAGGTAGGCAATGTGTCTTACAACTATGGAAAATCATTCAGTAAGATTTCAGAGAAGCTGAACTTTGGCGTGGGCAACA
ACAGCGAAGCTGTGATCTCCCAGTTCTACCACAGCCCTGCCGACAACAAGAGGTACATCTTTGTGGATGCTTACGCCCAA
TACCTCTGGATCACAGTTTGACTTCTGCAGCACATATCCATGGCTTCTCCATCCCATTCCGGGCGGCTGATCTCCTCCTC
CATAGCAAGGCCTCCAACCTCCTCTTGGGCTTTGACAGGTCTCACCCCAACAAGCAGCTATGGAAGTCAGATGATTTTGG
CCAGACCTGGATCATGATTCAGGAACACGTAAAGTCCTTCT
Sequence Type mRNA
Unitrap ID UNI21931

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 41898032..41907349 158
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000049313 (Sorl1) NM_011436 sortilin-related receptor, LDLR class A repeats-containing Gene [Source:MGI (curated);Acc:Sorl1-001]

 
Come back to gene ENSMUSG00000049313


For any suggestions or comments, please send an email to unitrap@crg.es