Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST313521
Clone ID OST313521
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST313521
Sequence
CGTCATGCAGAAGTATCTGGAGGACCGAGGAGAAGTGACCTTTGAAAAGATCTTTTCNCAGAAGTTAGGGTACCTGCTTT
TCCGGGACTTCTGCCTGAACCATCTGGAAGAGGCCAAGCCCTTGGTGGAGTTCTACGAAGAGATCAAGAAATATGAGAAG
CATGGAGACAGAGGAGGAACTGTGTGGTCCNGCAGCCGAGAGATCTTTGACTCCTATATTATGAAAGAACTGCTGGCCTG
CTCACANNCCTTTTNNAAGANTGCTACCGGANCNTGTCCAGGGCCACCTGNNGAACANGCANGTGCCTCCAGANCTNTTC
CAGNCATACAATTGNGGAGATNTGTCAGAACCTCCGAGGGGACGTGTTCCANAAGTTCATAGAGAGCGACCNGTCTACCN
TATTTCNGCCATTTGNCAANGAATGATNGAGCATCCAACCCCCACCTTG
Sequence Type mRNA
Unitrap ID UNI19447

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 4292170..4294917 94
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024858 (Adrbk1) NM_130863 adrenergic receptor kinase, beta 1 Gene [Source:MGI Symbol;Acc:MGI:87940]

 
Come back to gene ENSMUSG00000024858


For any suggestions or comments, please send an email to unitrap@crg.es