Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST313393
Clone ID OST313393
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST313393
Sequence
GACTGAGGAAAATGTTTATAGGAGGCCTTAGCTGGGCACACCACAAAGCAAAGATCTGAAGGACTACTTTTCCAAATTTG
GTGAAGTTGTAGACTGCACTCTGAAGTTAGATCCTATCACAGGGCGATCAAGGGGTTTTGGCGTTTGTGCTATTTAAAGA
GTCGGAGAGTGTAGATAAGGTCATGGATCAGAAAGAACATAAATTGAATGGGAAAGTCATTGATCCTAAAAGGGCCAAAG
CCATGAAAACAAAAGAGCCTGTCAAAAAAATTTTTGTTGGTGGCCTTTCTCCAGACACACCTGAAGAAAAAATAAGAGAG
TACTTTGGTGGTTTTGGTGAGGTTGA
Sequence Type mRNA
Unitrap ID UNI21706

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 100395039..100396408 166
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000000568 (Hnrnpd) NM_007516 heterogeneous nuclear ribonucleoprotein D Gene [Source:MGI Symbol;Acc:MGI:101947]

 
Come back to gene ENSMUSG00000000568


For any suggestions or comments, please send an email to unitrap@crg.es