Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST313390
Clone ID OST313390
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST313390
Sequence
GACTGAGGTCTAGCTGGGAGCTCCCCGACTCCAGGAAGGAAAGATCGAGGCCATCAGTGACTCTGATGGGGTGAACTATC
CCTGGTACGGCAATACCACGGAGACCTGCACGATTGTGGGGCCCACCAAGAGGGACTCCAAGTTCATCATCAGCATGAAC
GATAACTTCTACCCCAGCGTCACGTGGGCCGTGCCCGTCAGTGAGAGCAACGTGGCCAAACTGACCAACATCTACCGGGA
CCAGAGCTTCACCACGTGGCTGGTGGCCACCAACACCTCCACCAATGATATGATCATCCTGCAGACCCTGCACTGGCGCA
TGCAGCTGAGCATCGAGGTGAATCCCAACCGGCCCCTGGGCCAGCGCGCCAGGCTGCGGGAGCCCATTGCCCAGGACCAG
CCTAAAATCCTTAGCAAGAATGAGCCCATCCCGCCCAGTGCCCTGGTCAAGCCCAACGCCAACGATGCACAGGTCCTCAT
GTGGAGACCCAAGTACGGGCAGCCAT
Sequence Type mRNA
Unitrap ID UNI13193

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 31924795..31925295 497
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000050592 (A130092J06Rik) NM_175511 RIKEN cDNA A130092J06 gene Gene [Source:MGI Symbol;Acc:MGI:2443569]

 
Come back to gene ENSMUSG00000050592


For any suggestions or comments, please send an email to unitrap@crg.es