Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AH0155
Clone ID AH0155
Vector pGT0lxr
Project sanger

Sequence tag AH0155
Sequence
CCGGTTGCCGTGGTGCGGGTTTCACTTAGTAGCTGAGCCAGCTTGAATGGGCCTGTGTGCTGTGCTCCTTGTCCTGCCGC
TGGATGCTGTGGATTGTGCTCAGGCAAGCTCCGAAGTTGCGCCATG
Sequence Type mRNA
Unitrap ID UNI4672

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 98303055..98303180 126
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000074887 (A630089N07Rik) RIKEN cDNA A630089N07 gene Gene [Source:MGI Symbol;Acc:MGI:2444323]

 
Come back to gene ENSMUSG00000074887


For any suggestions or comments, please send an email to unitrap@crg.es