Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST312798
Clone ID OST312798
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST312798
Sequence
GACTGAGACGATGAGCAGCATGCTGGTGGACCTGCCTGCGGTGCCGCCCTGGCCGCCATCTACTCGGGCATCCTGTGGAG
GCTCCAGGCTGAGGGCCGCCTGAGTTCTGCCCTAGCTTCCGTTGTGGTCATCGTGTGCGGTGGCAACAACATTAGTAGCC
AACAGCTTCAGGAGCTGAAAATCCAGCTGGGCTGCAGCTGAAGAATCTCAGGAACTCCCCCAGAGGTTCCTGGACACCTT
GGTGGGTCACTCAAGGGACCTCGGTTCCAGTGGTCCTGCCCTCTTCCTTCCAGGTAGCCCTCCTGGGTTGCTCTCAGTGG
CTCCCTGCTGTCCAGTGAATAAACCTGACTGAGCTGAGAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI21675

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 120908210..120908562 346
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029596 (Sdsl) NM_133902 serine dehydratase-like Gene [Source:MGI (curated);Acc:Sdsl-002]

 
Come back to gene ENSMUSG00000029596


For any suggestions or comments, please send an email to unitrap@crg.es