Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST312736
Clone ID OST312736
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST312736
Sequence
GACTGAGGTGAATGAATATAAAGAANATGAACATATTGCTTATACTTCTCTGAGACCGATACAGATTACAACTTTAAGGA
AAACAGCTAAGGTTTATCTTTACCCGTTTTCACTCAGCAATTCCAAGCTAGGCCTACTTAAGTTGTCCAAATCCCCGGTT
GTAAATAATTCTAGCAAATCAGTGGTCCATAAGAAGAAAGATCGGAAGAAGACTCGTAGAAAGGTTTTAACTTCAAAAAT
GAAGGCCTTATCTTCCAAGGCAGATTCCCTTCTGCTGAAATCATCCGTGGATGCTTATACTGAAAGTACCAGGCTGGGAC
CCAAGAGGACCTCGGATTCAGCGACTCTCAGTGTGGACGCGGAAAGCAGCGACGAAGACAGTGCACCAGGCCTGGATGAT
TTTTCAGGATTGTCACCTTATGAAAGGAAGAGACTGAGGAACATCAGAGAAAANGCAAACTTTTTTGCTTCTCTTCAGTT
AGCTGAGTCGGCTGCACGGCTCCGTGGGATGATAAAGAAGCGCGAGTCACCTGAGT
Sequence Type mRNA
Unitrap ID UNI18180

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 121336273..121345202 389
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027242 (Wdr76) NM_030234 WD repeat domain 76 Gene [Source:MGI (curated);Acc:Wdr76-002]

 
Come back to gene ENSMUSG00000027242


For any suggestions or comments, please send an email to unitrap@crg.es