Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST312235
Clone ID OST312235
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST312235
Sequence
GACTGAGTTCCTGTGTGACGAGGGTGCGGGCATATCTGGGGACTACATTGACCGAGTAGATGAACCCGTCTCCTGCTCCT
ACGTACTGACCATTCGCACGTCAAGGCTCTGCCCGCATCCTCTCCTCCGGCCACCAGCCAGCGCTGCCCCACAGGCCATT
CTTTGTCACCCAGCCCTGCAGCCTGATGAGTACATGGCCTACCTCCAGAGGCAAGCTGAGTCAAAGCAGCATGAAGAGAA
AACCACAGAGGAAGTCCAGGACACAGACCGCCAAGTGTGGAGTGGGAGCAAGGCTGCCGGAGCACCCCCTTGTTCTTCAG
CAATCAGGTTTCTAAATAAAAAACTGGACCGTCA
Sequence Type mRNA
Unitrap ID UNI1968

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 126532707..126537353 213
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040462 (Os9) NM_177614 amplified in osteosarcoma Gene [Source:MGI Symbol;Acc:MGI:1924301]

 
Come back to gene ENSMUSG00000040462


For any suggestions or comments, please send an email to unitrap@crg.es