Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST311987
Clone ID OST311987
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST311987
Sequence
GACTGAGCATCCCACAGGGACACCGGCTCCAGCCTCTGCTGCACATTTCCCAACTCCTCAGAGAAGCAGTTGAAGACTGT
ACTCGTGGGTCTCCGCGAAATCCCTTTGAGAGCTGGTTTTTGTTTGTTCACTTTGGAGGATGGGTTGACCTGGCTGTGGC
AGAGTTACTGCTGAGGGAGGAAGCCTGAGCCTCCTGCTGGCCTGCTGTGGCTCTTGGTGTTCTATTACAGCCCACAGGAT
GGGAGTCAGCAGAGAGAGCAGAGCATGGTGGAGCTGAAGGTATTAATCAACCGTCTCCTGATGCTGCTCAGAAGCGGCCC
CCTCTCAGCTACTGATCTGCAGGAAGCAGCTGAGAGTCCCAGTGGAGACCCCAGACCACCTGTATGTGGACAGCTGGTCA
GACGCCTTCTTCTTAGTCTCTTGCTCTGGACCCCANAAGGCCATGCAATTGTCTGGGAAGCTGNCACCCATATGGCCCAC
ACGGATGCTG
Sequence Type mRNA
Unitrap ID UNI9392

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 63414093..63424795 201
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021461 (Fancc) NM_007985 Fanconi anemia, complementation group C Gene [Source:MGI Symbol;Acc:MGI:95480]

 
Come back to gene ENSMUSG00000021461


For any suggestions or comments, please send an email to unitrap@crg.es