Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST311986
Clone ID OST311986
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST311986
Sequence
TCTGAGAGCCTGGAAGTGGGGATCCGGTAGCAGTATTGAGCATGACGTGGTAATGAAGGCCAGCTCCAGCCTGCCTAAGA
GGCTTGCACTGCTGAAGGGAGCATCAAAGAAATCAGAAGCCACCATCCCTGGCAAGACACCATCCTGAAGGCACTGGGAC
TTTGCTGGTCACCCCACAGGCTGGCTGGACTTGGAAGAGGGCCCTGCTCCAGTCCTGGTGGCCCCTGGAACAATGGGCAG
GTGATGGTAAAGCCAGGCTAGCTCCCAAGGGCTGAAGGGTGCTCAGCCTCCTCTGCTGGTGTGATGATAAATGTGGCTCT
GTTGTCTCTCCAGCCATTCAGTGGGCATAATCTCACCCCCAGTCATCTAATGTCAGCCTGTCACACCAGTAATCCCGAGC
CACTTGGGGATGCTCCAGTGTTACCCAATAAAGCTGTGTCACAGAG
Sequence Type mRNA
Unitrap ID UNI20785

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 86770134..86770594 346
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000019362 (D8Ertd738e) NM_001007571 Leydig cell tumor 10 kDa protein homolog [Source:UniProtKB/Swiss-Prot;Acc:Q8R1F0]

 
Come back to gene ENSMUSG00000019362


For any suggestions or comments, please send an email to unitrap@crg.es