Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST311735
Clone ID OST311735
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST311735
Sequence
TGAAAACGAGTACAAAGTTTGGTACTACAGCACAAAGGTCCAGTTATTTGAGCTAATAGACTGCCNAGACNAAGGATACT
GGGAAGCAGAACTGTGCAGAGTTCTAGAAGACATTCGGGAGGAGATGCAGCAGNTATATGGATGTAACGGAAGACCTGAC
CAACAAGGCTCGTGGCAGCAACAAGTCCTTCCTAGCGGCAGCTAATGAGGAAATTTTGGACTCCTTAAGAATCAAACGAG
GGGAAGATATTGACTGTGATCAGAGCCCAGAAGACCCAGAAAAGGACAAGCATGAGGGCGAGAACAACAGCTCCAAGGAT
GCTGANAAGAGCAGGGAGGAGGCGGAGGACCCTTACGNAGACAAGGACGCTGACAGCAAAGGCCTGGAGGAAGAGCCCGG
GCATGGAAAACCTGAGGGTGA
Sequence Type mRNA
Unitrap ID UNI6861

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 106957028..106961085 207
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040481 (Bptf) bromodomain PHD finger transcription factor Gene [Source:MGI (curated);Acc:Bptf-002]

 
Come back to gene ENSMUSG00000040481


For any suggestions or comments, please send an email to unitrap@crg.es