Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST311505
Clone ID OST311505
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST311505
Sequence
GACTGAGAAACATCGGACCGTGTGGGACCAAGCAAGCCTGTGTCCCAACCCCGGCGGAACATCGTAGGCTGCAGGATCCA
GCATGGATGGAGAGAGGGCAATGGCCCTGTTACCCAGTGGAAGGGGACCTGTCCTGGACCAGGTGCCTGTGAATCCTTCC
CTGTATCTTATAAAGTACGATGGATTTGACATGTGTTTATGGACTAGAACTTAATAAGGATGAAAGAGTTTCTGCACTGG
AAGTCCTCCCTGATAGAGTTGCAACATCTCGGATCAGCGATGCACACTTAGCGGACACAATGATCGGCAAAGCAGTGGAG
CACATGTTTGAGACAGAGGACGGCTCTAAAGATGAGTGGAGGGGGGATGGNCTTGNCACGGNCGCCTGTCATGAACACAT
GGNTTTACATCACCTATGANAAAGACCCTGTCTTGNACATGTACCAGCTCCTNGATGACTACAAAGAAGGCGACCT
Sequence Type mRNA
Unitrap ID UNI20312

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 51234727..51239884 243
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021395 (Spin1) NM_146043 spindlin 1 Gene [Source:MGI Symbol;Acc:MGI:109242]

 
Come back to gene ENSMUSG00000021395


For any suggestions or comments, please send an email to unitrap@crg.es