Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST311169
Clone ID OST311169
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST311169
Sequence
GAACTGAGAGTGGGTTCCACATCAACCAGNAATATTTCTACCAACCTACAGGAAGCGAGAAGGTGCCAGAGATTGTGGGA
GAGGAGCAAGGTACAGTTGTGTACCAGCTAGATTCAGGTACCGTCATTGCGCTGAACAGTGAGTGACTAGCCATGATAAA
GTTACAGTAAACTTAGTGTGCACAATAAAAGTGATTTTAATTTTTAAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI22026

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 90634028..90634230 200
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040812 (Agbl2) NP_848870 ATP/GTP binding protein-like 2 Gene [Source:MGI (curated);Acc:Agbl2-004]

 
Come back to gene ENSMUSG00000040812


For any suggestions or comments, please send an email to unitrap@crg.es