Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST311073
Clone ID OST311073
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST311073
Sequence
ATCTCCTGTCTCTGCTGGCCATGATGCCTATGTTGATCTTGATCGCCAGTTGAAGAAAACTACCGAAGAACTAAATGAAG
CTTTGTCAGCAAAGGAGGAAATTGCTCAAAGATGCCATGAATTGGATATGCAGGTTGCAGCACTGCACGAGGAGAAAAGT
AGTTTATTGGCAGAAAATCAGATACTAATGGAACGACTCAATCAATCTGATTCTATNGNNGATCCCAATAGCCCAGCAGG
AAGAAGACATTTGCAACTTCAGACTCAGTTAGAACAGCTGCAAGAAGAAACATTCAGACTAGAAGCAGCCAAAGACGATT
ATCGAATCCGCTGTGAGGAGTTAGAAAAGGAAATCTCCGAGCTTCGGCCAGCAGAACGATGAGCTGACCACTTTGGCAGA
CGAAGCTCAGTCTCTAAAGGATGAANTAGACGTTCTCANACACCTCTCCTGATAAAGCATCTAAAACTA
Sequence Type mRNA
Unitrap ID UNI22032

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 27181531..27184168 159
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037234 (Hook3) NM_207659 hook homolog 3 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:2443554]

 
Come back to gene ENSMUSG00000037234


For any suggestions or comments, please send an email to unitrap@crg.es