Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST311050
Clone ID OST311050
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST311050
Sequence
CTGTCACCCCTCTGGGTGCCCCTTAGAGGCCATCCAGCCCAACCTGACCAATGTCCACAGCCAGGGAACAGCCAATCTTC
AGCACCCGGGCGCACGTATTCCAGATCGACCCCACTACAAAGCGGAACTGGATCCCCGCCGGNNAGCACGCACTTACCGN
GTCCTATTTNTATGATGCANCCCGAAATGTGTACCGCATCATCAGCATCGGGGGTGCCAAGGCCATCATCAACAGCACTG
TCACTCCCAACATGACCTTCACCAAAACCTCTCAGAAGTTCGGGCAATGGGCAGACAGTCGAGCCAACACTGTCTACGGC
CTAGGCTTTGCCTCTGAACAGCAGCTGACCCAGATATATTTGTATGCGTTTGTGTGCATTTGCATGCATTTGTATGTGCA
CAGGCCATGTGTGTGCTGATACCTCCAGAGGTCAGAGGGAACCATCAGATCTCCTGGAGCAGGAGGAACGGGCCATGGTT
AAGGCTCCTGACATAGGTGC
Sequence Type mRNA
Unitrap ID UNI18179

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 72809151..72810341 150
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000003573 (Homer3) NM_011984 homer homolog 3 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1347359]

 
Come back to gene ENSMUSG00000003573


For any suggestions or comments, please send an email to unitrap@crg.es