Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AD0435
Clone ID AD0435
Vector pGT0lxr
Project sanger

Sequence tag AD0435
Sequence
GATAAACTGCAGGATGGAGGGACTGCTGCATTACATCAACCCAGCACATGCTATCTCTCTGCTCAGTGCCCTCAATGAGG
AGCGCCTCAAGGGACAGCTGTGTGACGTGCTCGTGATTGTTGGGGACCAGAAATTCCGAGCTCATAAGAACGTATTGGCT
GCCAGCA
Sequence Type mRNA
Unitrap ID UNI4689

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 98174093..98174259 161
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000046962 (Zfp295) NM_001081684 zinc finger protein 295 Gene [Source:MGI Symbol;Acc:MGI:1927240]

 
Come back to gene ENSMUSG00000046962


For any suggestions or comments, please send an email to unitrap@crg.es