Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST310816
Clone ID OST310816
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST310816
Sequence
AAACTGGTGGCTGTTTGGACAAGGAAGAAAGCCGAAGGAAGTCTTCCAAGGCTCACAGNTGGCAACCTGGAATAAAAAAT
CCATATCGTGGTGTTGTTGTTTGNCCTGTCCCTGAAAACATTGAAATCACTGTGACGCTGTTTAAGGATCCTNATGCAGA
AGAATTTGAAGACAAAGA
Sequence Type mRNA
Unitrap ID UNI22041

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 22132027..22148020 93
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042302 (Ehbp1) NM_153078 EH domain binding protein 1 Gene [Source:MGI (curated);Acc:Ehbp1-001]

 
Come back to gene ENSMUSG00000042302


For any suggestions or comments, please send an email to unitrap@crg.es