Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AC0721
Clone ID AC0721
Vector pGT0lxr
Project sanger

Sequence tag AC0721
Sequence
GATGATGGAACAAGTGCATGGAGGACTGCAACAGAAGAGTGGGGAACTGAAGATCTGGAATGAAGAT
Sequence Type mRNA
Unitrap ID UNI3737

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 89832247..89832299 50
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042520 (Ubap2l) NM_028475 ubiquitin associated protein 2-like Gene [Source:MGI Symbol;Acc:MGI:1921633]

 
Come back to gene ENSMUSG00000042520


For any suggestions or comments, please send an email to unitrap@crg.es