Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AC0424
Clone ID AC0424
Vector pGT0lxr
Project sanger

Sequence tag AC0424
Sequence
ATAGAACAAGGCGCGCCCTTTGAAGGAAGAAACTGTCGCCGTAGAGCCATGGTGGGGCCCGGCCCCACTGCCAGCGCAGC
CGCGGAAGAACGGTGGCAGAAGCTCCAGGAGTACCTGGCAGCCAAGGGAAAGCTAAAGGACCCCAACGCCAAGCCTTATC
TAAAAGCCAAGAATATCTGCCCCAAACCACCACCATCTAAATAT
Sequence Type mRNA
Unitrap ID UNI4691

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 129116694..129122924 87
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000048327 (Ckap2l) NM_181589 cytoskeleton associated protein 2-like Gene [Source:MGI (curated);Acc:Ckap2l-001]

 
Come back to gene ENSMUSG00000048327


For any suggestions or comments, please send an email to unitrap@crg.es