Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST310339
Clone ID OST310339
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST310339
Sequence
GACTGAGCTCTCTACTCAAGGAGATGCAAGCCAGGTGATTGGACCTCTCACGGAAGGACAGAAGAGAAATGTGGGTGCGG
TGA
Sequence Type mRNA
Unitrap ID UNI4893

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 32554282..32554359 76
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035933 (Cog5) component of oligomeric golgi complex 5 Gene [Source:MGI Symbol;Acc:MGI:2145130]

 
Come back to gene ENSMUSG00000035933


For any suggestions or comments, please send an email to unitrap@crg.es